June 30, 2010

Insulin Resistance Lowers Odds of Hep C Treatment Success

June 30, 2010

People coinfected with both HIV and hepatitis C virus (HCV) are much less likely to respond to HCV treatment if they also have insulin resistance, according to a study published online June 25 in the Journal of Acquired Immune Deficiency Syndromes.

There are a number of factors that determine whether someone will respond successfully to HCV treatment—with success defined as maintaining undetectable HCV levels in the blood for at least six months following the conclusion of a course of HCV treatment—also known as a sustained virological response (SVR).

Some factors that reduce the likelihood of achieving an SVR, such as having certain strains of HCV, or being coinfected with both HIV and HCV, are not controllable. Other factors, such as low CD4 counts or insulin resistance, can potentially be treated. Insulin resistance occurs when the body makes insulin to break down blood sugar but doesn’t use the insulin efficiently. Over time it takes more and more insulin to keep blood sugar levels in balance, and a person can develop diabetes.

Several recent studies in people infected with only HCV have suggested that insulin resistance can lower the odds of responding well to HCV treatment. There have been no studies until now, however, to determine what impact insulin resistance might have on HCV treatment in people coinfected with both HIV and HCV.

To answer this question, Pablo Ryan, MD, from the Hospital Gregorio Marañón in Madrid, and his colleagues reviewed the medical records of 134 coinfected individuals who received standard HCV treatment (pegylated interferon plus ribavirin) between July 2000 and March 2007. The majority of the study participants, 67 percent, had HCV genotypes 1 or 4, which are most common in the United States and the most difficult to treat. Thirty-one percent had insulin resistance. Roughly 85 percent were on antiretroviral (ARV) HIV treatment.

Ryan and his colleagues found that people with insulin resistance did indeed respond less well to HCV treatment than those without insulin resistance. Overall, 67 percent of the participants achieved an SVR, provided that they had no insulin resistance. Meanwhile, only 25 percent of those with a high degree of insulin resistance achieved an SVR. In people with HCV genotypes 1 or 4, success rates ranged from a high of 43 percent in those with little to no insulin resistance to as low as 21 percent in people with a high degree of insulin resistance.

After accounting for a number of risk factors, those least likely to achieve an SVR were those with HCV genotypes 1 or 4, those with insulin resistance, and those who’d once had a very low CD4 count. Fortunately, many people can use ARV therapy to avoid the loss of CD4 cells, and insulin resistance can be improved in many with a proper diet, exercise and weight loss.

The authors conclude that health care providers should look for insulin resistance in their coinfected patients who are considering starting HCV treatment.

Search: hepatitis C, HCV, interferon, ribavirin, insulin resistance, diabetes, HIV

http://www.aidsmeds.com/articles/hepatitis_insulin_diabetes_1667_18671.shtml

Doctors warn of risk of liver cancer

Wed, 30/06/2010 - 20:14
Tarek Amin

Ten doctors specialized in liver disease have warned that more than half a million Egyptians risk dying each year of liver cancer.

At a medical conference held in Dubrovnik, Croatia, they said that liver cancer struck between 2 and 5 percent of Hepatitis C and B patients--a situation they described as "a national catastrophe."

"We will for the first time have access to a genetic map of liver cancer that will help us prescribe the right treatment," said conference participant Dr. Abdel Rahman el-Ziadi.

Dr. Ashraf Omar, for his part, said: "Most important is that we analyze the tissues of Cirrhosis patients to prevent the probability of liver cancer." He added that the genetic map would enable doctors to predict liver cancer relapses.

Dr. Amr Helmy, for his part, advised periodic liver tests aimed at the early detection of liver cancer, while Dr. Wahid Doss said the disease could be accurately detected except in its later stages.

Translated from the Arabic Edition.

http://www.almasryalyoum.com/en/news/doctors-warn-risk-liver-cancer

The Pros and Cons of the Virtual Hepatitis Community

From Charles Daniel, former About.com Guide

Updated June 22, 2009
About.com Health's Disease and Condition content is reviewed by the Medical Review Board

Joining a support group is a good way to learn about hepatitis (or any chronic disease) and to find out how other people work through the same problems you're probably having. Living with a chronic disease often requires lifestyle changes that seem overwhelming at first, but learning how other people handle them can make your life easier. Unfortunately, regularly attending a group may not be possible because of work or childcare schedules, or maybe there's just not a good group nearby. In this case, you could consider joining an Internet support forum. Are they just as good as a group that meets in person? As with most things, there are pros and cons.

Pros of Internet Support Groups

Anonymous. If you're uncomfortable letting others know you have chronic hepatitis, the virtual communities of the Internet offer relative secrecy and anonymity. For hepatitis, and any of the other stigmatized diseases, support forums can be places to post your questions and find information without revealing your identity. However, even though forums can be private, a good rule of thumb is never to post anything you absolutely wouldn't want to say aloud publicly.

Convenient. Even if you live in the biggest city that never sleeps, you can't find a support group that's always meeting. Traditional groups just can't compete with the 24/7 schedule of a virtual forum: they're always available. When you also take away the need to drive and park your car, the convenience of the online experience is unsurpassed.

Size. Traditional support groups tend to get difficult to manage if too many people attend. However, the Internet forum often thrives when hundreds participate. When more people log on, this means more eyes to read your posts and, hopefully, more responses for you.

Specific. Forums can be very specific. For example, there are online hepatitis groups for just women, or veterans, or Christians. Whatever your interests or identity, you can probably find a forum devoted specifically to that group. Of course, there are plenty of general forums, too, but at least you'll have the option. Maybe, you'll even consider joining several!

Cons of Internet Support Groups

It's Virtual. While anonymity is a benefit of the online forum, it's also one of its weaknesses. If you're like many others, you value personal interaction with people and you'll probably enjoy a higher quality of life if you get regular opportunities to meet with others.

No Oversight. Most support groups have an identified leader who is able to help guide the conversation and keep the conversation civil. While there are good moderated forums online, there are also many sites that have very little oversight and can quickly get out-of-hand. It's rarely helpful to participate in a forum where anything goes and people can say whatever they want or feel without regard to others.

No Affiliation. Many support groups have some affiliation, usually with a medical, community, or nonprofit organization, which helps to provide a level of credibility. These groups may follow a proven therapeutic model and have access to specially trained professionals. While virtual communities can have all this, too, it's likely that many don't.

Misinformation. Perhaps the greatest problem with Internet forums is the potential for misinformation. The above problems (anonymity, no oversight, and lack of affiliation) can easily lead to an environment where people can post all kinds of half-truths, misunderstandings, and flat out lies. While some forums have professional oversight, many have nothing that prevents someone from posting bad information. This puts a greater burden on you to choose a good forum with good qualities.

Ready to Join?
 
If you've made your choice, the next step is to find a good site and sign up. Here's a good place to start looking for Internet support groups. However, many people do both: participate in a regular group and an online site. No matter which you choose, here's help in finding the perfect support group.
 
If you've made your choice, the next step is to find a good site and sign up. Here's a good place to start looking for Internet support groups. However, many people do both: participate in a regular group and an online site. No matter which you choose, here's help in finding the perfect support group.
 
Suggested Reading
•What Makes a Good Support Group?
•How to Find the Perfect Support Group
•Four Good Hepatitis Support Forums
 
Source

Effects of preceding interferon therapy on outcome after surgery for hepatitis C virus-related hepatocellular carcinoma

Journal of Surgical Oncology
Published Online: 29 Jun 2010
Copyright © 2010 Wiley-Liss, Inc., A Wiley Company

Yoshito Tomimaru, MD, Hiroaki Nagano, MD, PhD *, Hidetoshi Eguchi, MD, PhD, Shogo Kobayashi, MD, PhD, Shigeru Marubashi, MD, PhD, Hiroshi Wada, MD, PhD, Masahiro Tanemura, MD, PhD, Koji Umeshita, MD, PhD, Naoki Hiramatsu, MD, PhD, Tetsuo Takehara, MD, PhD, Yuichiro Doki, MD, PhD, Masaki Mori, MD, PhD 

1. Department of Surgery and Hepatology, Graduate School of Medicine, Osaka University, Suita, Osaka, Japan
2. Department of Health Sciences and Hepatology, Graduate School of Medicine, Osaka University, Suita, Osaka, Japan
3. Department of Gastroenterology and Hepatology, Graduate School of Medicine, Osaka University, Suita, Osaka, Japan
email: Hiroaki Nagano (hnagano@gesurg.med.osaka-u.ac.jp)

*Correspondence to Hiroaki Nagano, Department of Surgery, Graduate School of Medicine, Osaka University, 2-2 Yamadaoka E-2, Suita, 565-0871 Osaka, Japan. Fax: 81-6-6879-3259.

Keywords
hepatocellular carcinoma (HCC) • interferon (IFN) • hepatitis C virus (HCV) • hepatic resection

Abstract

Background and Objectives
Interferon (IFN) can eradicate hepatitis C virus (HCV)-RNA from serum and hepatic tissue, and suppress the development of hepatocellular carcinoma (HCC). Despite such effectiveness, HCC develops even in HCV patients successfully treated with IFN therapy.

Methods
HCV-related HCC patients who underwent curative hepatectomy for HCC were divided into three groups according to preceding IFN for HCV infection therapy and the therapeutic effect: responders group (n = 23), non-responders group (n = 46), and no-IFN group (n = 215). Postoperative outcome was retrospectively examined in the three groups.

Results
AST and ALT were significantly lower in responders group than non-responders group (P < 0.001, P = 0.001) and no-IFN group (P = 0.001, P = 0.002). Platelet count was significantly higher in responders group than other groups (P = 0.008, P = 0.001). The percentage of cirrhotic patients in responders group was significantly lower than other groups (P = 0.017, P = 0.014). Multivariate analysis identified preceding IFN therapy to be associated with disease-free survival at marginal significance (P = 0.086), and as a significant independent factor for overall survival (P = 0.042).

Conclusions
Preceding IFN therapy for HCV infection improves postoperative outcome in HCV-related HCC patients treated successfully with IFN. J. Surg. Oncol. © 2010 Wiley-Liss, Inc.
Received: 27 February 2010; Accepted: 26 April 2010
Digital Object Identifier (DOI)
10.1002/jso.21633 About DOI

http://www3.interscience.wiley.com/journal/123563650/abstract?CRETRY=1&SRETRY=0

Use of Percutaneous Needle Biopsies Continues to Grow

By Todd Neale, Staff Writer, MedPage Today

Published: June 29, 2010
Reviewed by Zalman S. Agus, MD; Emeritus Professor
University of Pennsylvania School of Medicine and
Dorothy Caputo, MA, RN, BC-ADM, CDE, Nurse Planner
 
In recent years, there has been an increase in the use of percutaneous needle biopsies -- including those guided by advanced imaging -- and a shift away from more invasive biopsy techniques, researchers found.

Highlighting the growing use of imaging guidance, radiologists have taken on an increasing share of biopsies (from 35% in 1997 to 56% in 2008), Sharon Kwan, MD, of the University of California San Francisco, and colleagues reported online in the journal Radiology.

Kwan and her colleagues analyzed Medicare claims data for biopsies in 10 anatomic regions -- the abdomen and retroperitoneum, bone, breast, chest, kidney, liver, musculoskeletal soft tissue, pancreas, superficial lymph node, and thyroid -- from 1997 to 2008.

During that time, the researchers found that the proportion of biopsies performed percutaneously increased from 59% to 67%. The rise was seen for six of the 10 anatomic regions studied -- breast, chest, liver, lymph node, pancreas, and musculoskeletal soft tissue.

"A likely explanation [for the increase in percutaneous approaches] is that the relatively recent proliferation of CT, MR imaging, and ultrasound had an effect on the overall approach used for performing biopsies, because more lesions can be efficiently and safely targeted with a percutaneously inserted needle now that imaging guidance is more readily available."

Overall, biopsy procedures increased from 1,380 per 100,000 beneficiaries in 1997 to 1,945 in 2008, for a modest annual growth rate of 3%.

Over the study period, the number of percutaneous techniques rose by 5% a year, while nonpercutaneous approaches dropped 3% a year.

"Because percutaneous needle biopsy techniques were established well over a half-century ago, we might have expected that the distribution of biopsy approach would have stabilized prior to our study period," Kwan and colleagues commented.

In 2008, there were only two anatomic regions for which a minority of biopsies were performed percutaneously -- superficial lymph nodes (46%) and musculoskeletal soft tissues (30%). Open biopsies are associated with less morbidity in these superficial regions, according to the authors.

Most of the codes used in the analysis did not distinguish between biopsies performed with and without imaging guidance. However, codes specifying the use of imaging were introduced in 2001 and 2002 for breast biopsies and fine needle aspirations, respectively.

For both of these procedures, the proportion guided by imaging increased -- from 85% in 2002 to 95% in 2008 for breast core biopsies and from 54% in 2004 to 77% in 2008 for fine needle aspirations.

By the end of the study period, radiologists were performing most biopsies (56%), with the growth in that number increasing by 8% a year. However, the rate of growth of radiologist-performed biopsies slowed from 9% a year from 1997 to 2002 and to 6% from 2004 to 2008.

"One factor that might contribute to this slowdown is that other specialties are increasingly performing imaging-guided percutaneous biopsy," the researchers wrote.

They acknowledged some limitations, including some irregularities in the data for fine needle aspirations in 2003 and the lack of information on which anatomic regions were biopsied with fine needle aspiration.

In addition, the findings may not apply to a non-Medicare population, information on the use of imaging guidance was not available for all anatomic sites, and the researchers were not able to capture the full range of biopsy procedures for the abdomen.

The study was supported by a National Institute of Biomedical Imaging and Bioengineering grant.
The authors reported that they had no conflicts of interest.

Primary source: Radiology
Source reference:
Kwan S, et al "Effect of advanced imaging technology on how biopsies are done and who does them" Radiology 2010; DOI: 10.1148/radiol.10092130.

Source

FDA Approves First Generic Effexor Extended Release Capsules to Treat Major Depressive Disorder

FDA NEWS RELEASE

For Immediate Release: June 29, 2010
Media Inquiries: Sandy Walsh, 301-796-4669, sandy.walsh@fda.hhs.gov
Consumer Inquiries: 888-INFO-FDA

On June 28, the U.S. Food and Drug Administration approved the first generic version of Effexor XR capsules (venlafaxine hydrochloride) to treat major depressive disorder.

Venlafaxine hydrochloride extended-release capsules in 37.5 milligram, 75 milligram and 150 milligram strengths have been approved to be manufactured by TEVA Pharmaceuticals, North Wales, Pa.

“The approval of this widely used antidepressant is another example of the FDA’s efforts to increase access to safe and effective generic drugs,” said Keith Webber, Ph.D., deputy director of the Office of Pharmaceutical Science in the FDA’s Center for Drug Evaluation and Research. “Access to treatments for depression is important because depression can interfere with a person’s daily life and routine, which can significantly affect relationships with family and friends.”

Symptoms of depression can include feelings of sadness, anxiety, emptiness, hopelessness, guilt, worthlessness or helplessness. Irritability and restlessness are also common symptoms of depression. Many people with depression lose interest in activities or hobbies and feel tired all the time.

The prescribing information (label) for the generic drug may differ from that of Effexor XR capsules because some uses of the drug and parts of the label are protected by patents and/or exclusivity held by the Effexor manufacturer, Wyeth Pharmaceuticals Inc.

Generic venlafaxine hydrochloride will have the same safety warnings as Effexor XR.

The drug has a boxed warning indicating that antidepressant medicines may increase suicidal thoughts or actions in some children, teenagers, and young adults within the first few months of treatment. The warning also notes that depression and other serious mental illnesses are the most important causes of suicidal thoughts and actions. Some people may have a particularly high risk of having suicidal thoughts or actions. These include people who have or have a family history of bipolar illness (also called manic-depressive illness) or suicidal thoughts or actions.

http://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm217624.htm

Clues to Preventing Return of Liver Cancer

Small study finds antiviral therapy halts recurrence in patients with chronic hepatitis B

TUESDAY, June 29 (HealthDay News) -- Antiviral therapy may halt or slow recurrence of liver cancer in patients with chronic hepatitis B and extend their lives, finds a new study.

Previous research has shown that antiviral therapy reduces the incidence of liver cancer in such patients.

This study looked at 15 patients with chronic hepatitis B (CHB) who underwent the local removal of a liver tumor known as a "single hepatocellular carcinoma" (HCC) that was less than four centimeters. HCC is the most common primary malignant tumor of the liver.

Six of the patients were diagnosed between 1991 and 1997, prior to the development of antiviral therapy. They were classified as historical controls.

The other nine were diagnosed between 2000 and 2004 and began ongoing antiviral therapy with lamivudine immediately after HCC diagnosis. In some cases, patients were also prescribed other antiviral medications, such as tenofovir and adefovir.

Median survival among patients who received antiviral therapy immediately after HCC diagnosis was 60 months, compared with 12.5 months for the historical control patients. Seven of the nine patients who began immediate antiviral therapy have not developed a new HCC or recurrence. The longest survivors have been cancer-free for more than 10 years.

"Before the antiviral drugs were developed, patients would often develop new lesions within a few months of tumor [removal] because we were not treating the underlying virus that is causing the cancer. The virus drives the cancer, and by suppressing the virus ... we can extend the survival of these patients," study author Dr. Hie-Won Hann, a professor of medicine at Jefferson Medical College of Thomas Jefferson University, said in a university news release.

Another option for patients with recurrent liver cancer is a liver transplant, which carries its own risk and is not always available.

Antiviral therapy, like virtually all therapies, is not risk-free. Common side effects of lamivudine, for example, include appetite loss, diarrhea, indigestion, and fatigue; more rare severe side effects that require immediate medical attention include a severe allergic reaction (rash, itching, chest tightness and swelling of the mouth, lips, face or tongue; dark urine; fast or irregular heartbeat; and yellowing of the eyes or skin.

The study was recently published in the International Journal of Cancer.

SOURCE: Thomas Jefferson University, June 24, 2010, news release

http://www.nlm.nih.gov/medlineplus/news/fullstory_100526.html

IL28B polymorphism determines treatment response of patients with hepatitis C genotypes 2 or 3 who do not achieve a rapid virologic response

Article in Press

Gastroenterology June 2010 -

full text pdf attached

Alessandra Mangia, Liver Unit, IRCCS Casa Sollievo della Sofferenza Hospital, San Giovanni Rotondo, Italy Alexander J. Thompson, Duke Clinical Research Institute and Duke University Medical Center, Durham, NC, USA Rosanna Santoro, Liver Unit, IRCCS Casa Sollievo della Sofferenza Hospital, San Giovanni Rotondo, Italy Valeria Piazzolla, Liver Unit, IRCCS Casa Sollievo della Sofferenza Hospital, San Giovanni Rotondo, Italy Hans L. Tillmann, Duke Clinical Research Institute and Duke University Medical Center, Durham, NC, USA Keyur Patel, Duke Clinical Research Institute and Duke University Medical Center, Durham, NC, USA Kevin V. Shianna, Institute for Genome Sciences & Policy, Center for Human Genome Variation, Duke University, Durham, NC, USA Leonardo Mottola, Liver Unit, IRCCS Casa Sollievo della Sofferenza Hospital, San Giovanni Rotondo, Italy Daniela Petruzzellis, Liver Unit, IRCCS Casa Sollievo della Sofferenza Hospital, San Giovanni Rotondo, Italy Donato Bacca, Department of Internal Medicine, Hospital Castrano, Italy Vito Carretta, Department of Internal Medicine Hospital Venosa, Italy Nicola Minerva, Department of Internal Medicine, Hospital Canosa, Italy David B. Goldstein, Institute for Genome Sciences & Policy, Center for Human Genome Variation, Duke University, Durham, NC, USA John G. McHutchison, Duke Clinical Research Institute and Duke University Medical Center, Durham, NC, USA

Received 17 February 2010; received in revised form 23 April 2010; accepted 25 May 2010. published online 04 June 2010. Accepted Manuscript

Abstract

Background & Aims

Polymorphisms in the region of the interleukin (IL)28B gene on chromosome 19 have been associated with peginterferon-a (pegIFN)-induced clearance of genotype 1 hepatitis C virus (HCV); there are no data for patients with genotypes 2 or 3 (G2/3) HCV. We evaluated the effects of IL28B polymorphisms on response to treatment with pegIFN and ribavirin in a well-characterized cohort of G2/3 patients.

Methods

DNA was analyzed from 268 patients (Caucasian, G2=213, G3=55). Patients were randomly assigned to groups that received standard (24 weeks, SD24, n=68) or variable durations of therapy. Patients that received variable durations and had a rapid virological response (RVR) were treated for 12 weeks (VD12, n = 122); those without a RVR were treated for 24 weeks (VD24, n=78). IL28B genotypes (rs12979860) were analyzed for association with treatment response.

Results

The frequencies of the IL28B genotypes were: CC=37%, CT=48%, TT=15% ; 82% of patients with the CC genotype achieved a SVR, compared to 75% with the CT and 58% with the TT genotypes (P = 0.0046). Differences between IL28B genotypes were greatest among patients who failed to attain RVR (VD24 SVR rates: CC=87%, CT=67%, and TT=29%, P=0.0002). Among patients with RVRs (61%), the IL28B genotype was not associated with SVR (>70% for all IL28B genotypes). In a multi-variable logistic regression model, IL28B genotype predicted SVR (odds ratio=1.76; 95% confidence interval=1.16 - 2.7).

Conclusions

An IL28B polymorphism was associated with a SVR in patients infected with genotypes 2 or 3 HCV who did not achieve a RVR. Analysis of IL28B genotype might be used to guide treatment for these patients.

INTRODUCTION

Several viral and host-related factors determine the outcome of peginterferon-α (PegIFN) and ribavirin (RBV) treatment in patients with chronic hepatitis C virus (HCV) infection. In addition to viral genotype, serum HCV RNA level and stage of hepatic fibrosis, host genetic factors have recently been identified to influence treatment responsiveness in patients with chronic hepatitis C. Single nucleotide polymorphisms (SNPs) on a linkage disequilibrium block encompassing two interferon lambda genes on chromosome 19 have been strongly associated with response to pegIFN plus RBV combination treatment in three genome wide association studies of HCV genotype 1 infected patients 1-3. The strongest association signal to date has been for the SNP rs12979860 1. Adherent patients with the CC genotype of rs12979860 were more than twice as likely to respond to 48 weeks of treatment as compared to the non-CC genotypes1. Although the mechanism by which this genetic variant acts remains unclear, it is likely to influence innate antiviral immune responses. The influence of this genetic variation on response to shorter treatment courses in patients chronically infected with genotype 2 or 3 HCV is not known.

The current standard therapy for HCV genotype 2 and 3 infection is 24 weeks of pegIFN plus RBV, which cures approximately 80% of patients 4. In recent years, refinements to this regimen have been developed to minimize side effects and costs. In patients with low viral load at baseline who attain week 4 rapid virological response (RVR), 12 - 16 weeks of therapy is associated with rates of SVR that are comparable to those attained after a standard 24 weeks of treatment 5-7 . Although relapse rates may be somewhat higher with shorter therapy 8, the cost-effectiveness of this approach has been demonstrated 6, 9. Individualized therapy for patients with genotype 2/3 HCV infection according to RVR has recently been included in a number of European treatment guidelines 10, 11.

We have now investigated the relevance of IL28B genetic variation to treatment response in a well characterized cohort of European patients with genotype 2 or 3 HCV infection who were treated with pegIFN-alpha-2b and weight-based RBV for 12 or 24 weeks duration according to week 4 virological response, as previously published 5.

DISCUSSION

To our knowledge this is the first report of the role and relevance of the recently described IL28B genetic polymorphism to PegIFN and RBV treatment outcome in the setting of chronic infection with genotype 2 or 3 HCV. This unique cohort, from a prospectively performed landmark clinical trial 5, has allowed us to carefully evaluate the interaction between this genetic determinant and treatment response in patients who received a variable duration of therapy based upon week 4 virologic response.

The data indicate that the IL28B polymorphism is relevant to treatment outcome, although the effect size was attenuated in these genotype 2/ 3 infected European patients, compared to the original observation in North American patients with genotype 1 HCV infection (genotype 2/3: 1.76 [95% CI 1.16 - 2.66], Table 4A, vs genotype 1: OR 5.2 [95%CI 4.1 - 6.7] 14). The attenuation of overall effect size was largely due to the much higher rates of RVR that occurred in the genotype 2/3 patients; IL28B-type did not influence outcome in these rapid responders. The major effect of this genetic variant was in patients who did not achieve a rapid response at week 4, where IL28B-type had a strong influence on the rate of SVR. A second point of contrast between this cohort and the genotype 1 North American cohort previously reported 14 was that the presence of a single C allele was noted to confer significant clinical benefit. In contrast, in genotype 1 HCV infection, the clinical benefit was more restricted to IL28B CC homozygotes 14.

Despite the association between IL28B-type and overall SVR, there was no significant association between the IL28B polymorphism and week 4 viral clearance, although RVR was numerically higher in CC and CT patients compared to TT patients. However, by week 8, viral clearance was clearly more common in CC and CT patients. We interpret this to mean that the IL28B polymorphism is associated with differential viral kinetics, similar to that observed in genotype 1, but that the different rate of decline between IL28B-types is attenuated, such that rates of viral clearance were not demonstrably different by week 4, but were significantly different at week 8. It is likely that quantitative measures of viral load may have been more sensitive for differentiating kinetics between patients with different IL28B-types, but unfortunately such measures were not available. We therefore acknowledge that the lack of HCV RNA decline evaluation represents a possible limitation of this study and that HCV RNA viral decline could have shown a better correlation with the IL28B genetic variant.

The study was not powered to formally evaluate the utility of IL28B-type for making decisions about selecting RVR patients for 12 weeks of therapy. Current guidelines recommend this approach for RVR patients with genotype 2/3 HCV infection and low viral load 10, 11. It is tempting to speculate that such treatment would be most suitable for CC patients. Although our data would be consistent with this being a subgroup of RVR patients most likely to achieve equivalent response rates, no significant difference was noted between 12 and 24 weeks of therapy in this cohort and we cannot draw firm conclusions. What appears more impressive is the potential role for IL28B genotyping in selecting non-RVR patients for standard 24 week therapy or more prolonged therapy. Prospective studies randomizing patients according to IL28B-type will be necessary to address both of these issues.

Of interest and as previously reported by Ge et al. in a genotype 1 HCV cohort 1, we also noted that the prevalence of the favourable C allele was lower in genotype 2/3 HCV-infected patients than in the non-HCV control population. This suggests that the T allele is associated with persistence, and is consistent with the recent observation that the IL28B CC-type is associated with spontaneous clearance following acute HCV infection 13, 15. The data therefore suggest that the role of IL28B variants in spontaneous clearance may be independent of HCV genotype.

Finally, the identification that genetic variation in the IL28B gene region is associated with pegIFN treatment outcome raises the possibility that IL28B might have therapeutic potential. IL28B (or IFN-lambda (α)-3) is one of three members of the IFN-α family, first identified in 2003 16, 17. All 3 members signal via a common IFN- α receptor, to trigger an IFN-stimulated gene response that overlaps considerably with the downstream signaling pathway of type 1 IFNs. Antiviral activity against both HCV and HBV has been demonstrated in vitro 18. Phase 1 studies investigating IL29 (IFN-α-1) have recently confirmed an anti-HCV effect in genotype 1 non-responders 19. Phase II development in a genotype 1-na•ve population is planned. The efficacy of IL29 in the setting of genotype 2/3 HCV is yet to be studied.

In conclusion, these findings highlight the importance of the interaction between HCV genotype and host genetic determinants in influencing treatment response. We have demonstrated that genetic variation in IL28B is associated with treatment response in patients infected with genotype 2/3 HCV. This effect is attenuated compared to previous reports in genotype 1 HCV, consistent with the recognized IFN-sensitivity of these genotypes, and also suggesting that key differences in the ability to evade innate antiviral immune responses are likely to exist between genotype 1 and genotype 2/3 HCV. IL28B- type was particularly important in patients who did not achieve RVR. Further prospective randomized studies are needed to investigate whether patients without RVR carrying the IL28B non-CC genotypes benefit from extended treatment duration.

http://www.natap.org/2010/HCV/062810_05.htm

Evidence for separation of HCV subtype 1a into two distinct clades

Journal of Viral Hepatitis

Early View (Articles online in advance of print)
Published Online: 21 Jun 2010
© 2010 Blackwell Publishing Ltd

B. E. Pickett 1 , R. Striker 2,3 and E. J. Lefkowitz 1
1 Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL, USA ; 2 W. S. Middleton Memorial Veterans Administration Hospital, Madison, WI, USA; and 3 Departments of Medicine and Medical Microbiology & Immunology, University of Wisconsin, Madison, WI, USA

Correspondence to Elliot Lefkowitz, BBRB 276/11, 1530 3rd Ave S, Birmingham, AL 35294-2170, USA. E-mail: elliotl@uab.edu

KEYWORDS
bioinformatics • drug resistance • hepatitis C virus • phylogeny • selection pressure

ABSTRACT
Summary. The nucleotide sequence diversity present among hepatitis C virus (HCV) isolates allows rapid adjustment to exterior forces including host immunity and drug therapy. This viral response reflects a combination of a high rate of replication together with an error-prone RNA-dependent RNA polymerase, providing for the selection and proliferation of the viruses with the highest fitness. We examined HCV subtype 1a whole-genome sequences to identify positions contributing to genotypic and phenotypic diversity. Phylogenetic tree reconstructions showed two distinct clades existing within the 1a subtype with each clade having a star-like tree topology and lacking definite correlation between time or place of isolation and phylogeny. Identification of significant phylogenetically informative sites at the nucleotide level revealed positions not only contributing to clade differentiation, but which are located at or proximal to codons associated with resistance to protease inhibitors (NS3 Q41) or polymerase inhibitors (NS5B S368). Synonymous/nonsynonymous substitution mutation analyses revealed that the majority of nucleotide mutations yielded synonymous amino acids, indicating the presence of purifying selection pressure across the polyprotein with pockets of positive selection also being detected. Despite evidence for divergence at several loci, certain 1a characteristics were preserved including the length of the alternative reading frame/F protein (ARF/F) gene, and a subtype 1a-specific phosphorylation site in NS5A (S349). Our analysis suggests that there may be strain-specific differences in the development of antiviral resistance to viruses infecting patients who are dependent on the genetic variation separating these two clades.

Received January 2010; accepted for publication April 2010

DIGITAL OBJECT IDENTIFIER (DOI)
10.1111/j.1365-2893.2010.01342.x About DOI
 
Source

Immune cell reservoirs of persisting hepatitis C virus

Gut 2010;59:867-868 doi:10.1136/gut.2010.210054

Commentary

Tomasz I Michalak

Author Affiliations
Molecular Virology and Hepatology Research Group, Faculty of Medicine, Health Sciences Center, Memorial University, St. John's, Newfoundland, Canada

Correspondence to
Professor Tomasz I Michalak, Molecular Virology and Hepatology Research Group, Faculty of Medicine, Health Sciences Center, 300 Prince Philip Drive, Memorial University, St. John's, NL A1B 3V6, Canada; timich@mun.ca

Infection with hepatitis C virus (HCV) is a global health problem with more than 80% of those infected developing chronic hepatitis C (CHC) that tends to advance to liver cirrhosis and hepatocellular carcinoma. It is estimated that up to three-quarters of HCV-infected individuals are neither diagnosed nor aware that they are infected, and symptomatic liver damage may not appear for years or decades in many patients following virus exposure. The pathogenic and epidemiological significance of HCV could be further magnified by the existence of occult HCV infection (OCI), evidenced by small quantities of HCV RNA in plasma (usually below 100 virus genome copies/ml), liver and/or peripheral blood mononuclear cells (PBMCs), continuing in the context of essentially normal liver function tests after self-limited or therapeutically induced resolution of hepatitis C and OCI in which carriage of HCV RNA traces coincide with moderately elevated liver enzymes of unclear aetiology.1 Although HCV is conventionally known to target hepatocytes, a large and increasing body of experimental and clinical data provides cumulative, hence not yet commonly acknowledged evidence that HCV also propagates at extrahepatic locations, particularly in cells of the immune system.2 3

HCV is a positive single-stranded RNA virus of the Flaviviridae family that demonstrates remarkable genetic variability and typically exists in an infected host as a heterologous population of closely related quasispecies resulting from virus rapid replication driven by an error-prone polymerase. The virus propagates by making a replicative intermediate, designated as the negative or the anti-genomic strand, which detection is a marker of actually progressing virus replication. The 5′-untranslated region (5′-UTR) of virus genome contains an internal ribosome entry site (IRES) essential for viral RNA translation. This sequence is highly conserved among different HCV genomes and arise of variants within this region is an indicator of usually sustained virus change. In this context, HCV derived from extrahepatic locations tend to display variations in the IRES sequence when compared to the genomes from plasma and liver. Some of these substitutions are located at particular nucleotide positions and coincide with modified IRES transcriptional efficiency, suggesting that they may reflect virus adaptation to propagate in a nonhepatic environment.4 In general, compartmentalisation of HCV variants in immune cells is considered as an indicator of hepatocyte-independent virus replication.5

The evidence of HCV replication were found in circulating immune cells, including total PMBC and their B cell, T cell and monocyte/macrophage subsets, dendritic cells, and in lymph nodes in patients with CHC or persistent asymptomatic infection. HCV replication in the immune cells was ascertained by molecular and immunocytochemical analyses, including detection of HCV RNA negative (replicative) strand, viral proteins, and HCV variants distinct from those occurring in patients' plasma and livers. Also, conditions upregulating HCV replication in immune cells and consequently facilitating more readily virus detection in cases with low virus load were established by ex vivo cell stimulation with mitogens differentially activating immune cell subtypes.

Support for the lymphotropic nature of HCV also stemmed from studies applying primary as well as transformed or immortalised lymphoid cell cultures exposed to wild-type virus or cells derived from HCV-infected patients adapted to survive in culture. Along this line, HCV propagation has been demonstrated in Epstein–Barr virus-transformed B cells isolated from PBMC of patients with CHC,6 in vitro infected human T cell lines,7 and in macrophages.8 In regard to infection of primary cells, the ability of human T lymphocytes to support replication of wild-type HCV leading to a release of infectious virus particles with physical properties distinct from those of plasma virions was demonstrated. This T cell infection was associated with emergence of HCV IRES variants, of which some carried mutations identical to those found in immune cells of HCV-infected patients. The infection was prevented following virus neutralisation with antibodies against HCV envelope E2 protein, blocking with antibodies to CD81 (a postulated HCV receptor molecule), and treatment of T cells with interferon α.9 The susceptibility of primary B cells and monocytes to de novo HCV infection was also examined and their ability to support replication, although at low efficiency, has been shown by different groups. Overall, evidence of active propagation of HCV has been uncovered in the main immune cell subtypes independent of whether infection is symptomatic or clinically silent, as well as in in vitro infection experiments with wild-type virus. Due to generally low virus load per cell and relatively small numbers of circulating or in vitro immune cells infected, investigations on HCV lymphotropism remain challenging, require sensitive detection techniques and meticulous approaches.

The propensity of HCV to infect cells of the immune system is consistent with observations of a significantly greater prevalence of HCV infection in lymphoproliferative disorders, such as mixed cryoglobulinaemia and non-Hodgkin's B cell lymphoma. However, a direct pathogenic role of HCV in the development of these diseases is not yet established.

In this issue of Gut, Durand and colleagues10 provide valuable insights into the sequence characteristics and the cell-specific replication potency of HCV variants residing in B cells in patients with a history of CHC and high plasma loads of HCV RNA (see page 934). An interesting and consistent feature of all six patients selected for the study was occurrence in affinity-purified B cells of HCV IRES variants which were not encountered in the genomes in the patients' plasma. Considering this attribute, the authors referred to this infection as occult B cell infection. In the B cell isolates from two cases, HCV RNA negative strand was detected independently confirming progressing replication. By testing translational activity of the plasmid constructs carrying B cell-specific IRES sequences and those from genomes occurring in plasma, the authors demonstrated a poor translational efficacy of the B cell specific IRES-es in liver-derived hepatoma Huh7 cells and primary human hepatocytes but not in B cell lines, such as Raji and Daudi. They also observed a comparable translational efficiency of IRES variants found in different patients in the same compartment (B cells vs. plasma) and a greater translational independence of the B cell specific IRES-es from a potent trans-acting factor (lupus antigen) than those from plasma genomes. Taken together, the data suggest that HCV variants residing in B cells differ in their translational capacity from those occurring in plasma, which should predominantly originate from infected livers, and that they are better adapted to propagate in B cells than hepatocytes. Despite limitations posed by the translation approach used, since only the IRES sequences alone out of the context of the complete virus genome were investigated, the study provides further support for the existence of extrahepatic HCV replication. Propagation of HCV in the immune system may have implications both for spreading virus variants potentially escaping immune and antiviral agent elimination and by modifying immune cell functions in ways promoting virus persistence.

Footnotes
Linked articles 192088.

Competing interests None.

Provenance and peer review Commissioned; not externally peer reviewed.

References

1.↵Pham TNQ, Coffin CS, Michalak TI. Occult hepatitis C virus infection: what does it mean? Liver Intl 2010;30:502–11.[CrossRef]
2.↵Blackard JT, Kemmer N, Sherman KE. Extrahepatic replication of HCV: insights into clinical manifestations and biological consequences. Hepatology 2006;44:15–22.[CrossRef][Medline][Web of Science]
3.↵Zignego AL, Giannini C, Monti M, et al. Hepatitis C virus lymphotropism: lessons from a decade of studies. Digest Liver Dis 2007;39(1 Suppl):S38–45.[CrossRef]
4.↵Laporte J, Bain C, Maurel O, et al. Differential distribution and internal translation efficiency of hepatitis C virus quasispecies present in dendritic and liver cells. Blood 2003;101:52–7.[Abstract/FREE Full text]
5.↵Di Liberto G, Roque-Afonso AM, Kara R, et al. Clinical and therapeutic implications of hepatitis C virus compartmentalization. Gastroenterology 2006;131:76–84.[CrossRef][Medline]
6.↵Sung VM-H, Shimodaira S, Doughty AL, et al. Establishemnt of B-cell lymphoma cell lines persistently infected with hepatitis C virus in vivo and in vitro: the apoptotic effects of virus infection. J Virol 2003:77:2134–46.[Abstract/FREE Full text]
7.↵Shimizu YK, Iwamoto A, Hijikata M, et al. Evidence for in vitro replication of hepatitis C virus genome in a human T-cell line. Proc Natl Acad Sci USA 1992;89:5477–81.[Abstract/FREE Full text]
8.↵Laskus T, Radkowski M, Jablonska M, et al. Human immunodeficiency virus facilitates infection/replication of hepatitis C virus in naive human macrophages. Blood 2004;103:2854–3859.
9.↵MacParland SA, Pham TNQ, Guy CS, et al. Hepatitis C persisting after clinically apparent sustained virological response to antiviral therapy retains infectivity in vitro. Hepatology 2009;49:1431–41.[CrossRef][Medline]
10.↵Durand T, Di Liberto G, Colman H, et al. Occult infection of peripheral B-cells by hepatitis C variants which have low translational efficiency in cultured hepatocytes. Gut 2010;59:934–42.[Abstract/FREE Full text]
 
http://gut.bmj.com/content/59/7/867.full

Interleukin-28B genetic variants and hepatitis virus infection by different viral genotypes in Spain

Hepatology July 2010

Marco Antonio Montes-Cano 1, Jose Raul Garcia-Lozano 1, Cristina Abad-Molina 1, Manuel Romero-Gomez 2, Natalia Barroso 3, Jose Aguilar-Reina 3, Antonio Nunez-Rold‡n 1, Maria Francisca Gonz‡lez-Escribano 1 * 1Servicio de Inmunologia, Hospital Universitario Virgen del Rocio/Instituto de Biomedicina de Sevilla (IBIS), Sevilla, Spain 2UCM de enfermedades digestivas y Ciberehd, Hospital Universitario de Valme, Universidad de Sevilla, Sevilla, Spain 3Servicio de Digestivo Hospital Universitario Virgen del Rocio, Sevilla, Spain email: Maria Francisca Gonz‡lez-Escribano (mariaf.gonzalez.sspa@juntadeandalucia.es)

*Correspondence to Maria Francisca Gonz‡lez-Escribano, Servicio de Inmunologia, Hospital Universitario Virgen del Rocio, 41013 Sevilla, Spain Potential conflict of interest: Nothing to report. fax: (34)-95-501-3221

Funded by:
FIS 07/0061 Fondos FEDER and Plan Andaluz de Investigacion; Grant Number: PAI, grupos CTS-0197, CTS-0102

Abstract

Genetic host factors may modify the course of the hepatitis C virus (HCV) infection. Very recently, a genome-wide scan that reported association of the IL28B locus with response to treatment in HCV infection was published. The aim of the current study was to investigate the relationship of this locus with outcome of HCV infection in a cohort constituted by a total of 731 Spanish individuals. From these, 284 were subjects with persistent infection, 69 were individuals who naturally cleared the virus, and 378 were noninfected subjects. Genotyping of the rs12979860 (C>T) in the IL28B locus was performed using a TaqMan 5 allelic discrimination assay. The CC genotype was overrepresented among patients infected with viral genotypes non-1 (66.7% versus 39.1% in patients infected with viral genotype-1, P = 8.5 x 10-5, odds ratio [OR] = 0.32, 95% confidence interval [CI] 0.17-0.60); patients with spontaneous resolution of infection (72.5% versus 45.6% of the individuals with persistent infection, P = 6.2 x 10-5, OR = 0.32; 95%CI, 0.18-0.57); and lastly, patients with sustained response (60.2% versus 32.1% found in patients with nonsustained response, P = 3.1 x 10-5, OR = 0.31; 95%CI, 0.17-0.56). Conclusion: We have found different rates of viral genotype infection depending on the IL28B variant as well as an association of this locus with natural and treatment-mediated response.

Hepatitis C virus (HCV) infection is estimated to affect 170 million people worldwide. This infection results in a chronic active hepatitis in more than 80% of the infected patients, of which 20%-30% develop progressive fibrosis and cirrhosis, whereas only approximately 10%-20% of the infected people spontaneously eliminate the virus.[1] Different factors may influence the ability to spontaneously clear the virus. Ethnic differences in clearance frequency suggest involvement of host genetic variations in spontaneous viral clearance.[2] Currently, the most effective initial therapy for viral clearance is the combination of interferon-alpha (IFN-) and rivabirin (RBV); however, this standard therapy does not produce sustained response in all the patients treated. Different factors have been evaluated as predictors of the sustained response to treatment, with controversial results.[3] Very recently, a genome-wide association study identified a single nucleotide polymorphism (SNP) rs12979860 (C>T) that was strongly associated with sustained virological response to the treatment with pegylated IFN- and RBV in a cohort of more than 1600 American individuals (with different ethnicity) chronically infected with the genotype 1 of the HCV.[4] This SNP is located on chromosome 19q13, 3 kilobases (kb) upstream of the interleukin-28B (IL28B) gene that encodes a type III IFN (IFN-3). Almost simultaneously with this first study, another two genome-wide association studies reporting an association of the response to IFN- and RBV treatment with the IL28B locus (although with different SNPs) have been published in Australian and a Japanese patient cohorts.[5][6] An association of rs12979860 with natural viral clearance in six different cohorts of individuals with diverse ethnic origins has also been reported.[7] The aim of this study was to explore the influence of the rs12979860 variations in the outcome of HCV infection in the Spanish population.

Abbreviations:

CHC, chronic hepatitis C; CI, confidence interval; G1, viral genotype 1; HCV, hepatitis C virus; IFN- interferon alpha; IL28B, interleukin-28B; NIS, noninfected subjects; NSR, nonsustained response; OR, odds ratio; RBV, ribavirin; SNP, single-nucleotide polymorphism.

Data of distribution of rs12979860 genotypes in males and females with spontaneous viral clearance are also displayed.

* Comparison spontaneous viral clearance versus chronic hepatitis; P = 6.2 x 10-5; OR = 0.32; 95% CI, 0.18-0.57.
Comparison spontaneous viral clearance versus noninfected subjects; P = 2.2 x 10-5; OR = 0.31; 95%CI, 0.17-0.56.
Comparison spontaneous viral clearance males versus females; P = 1.0.


Data of distribution of rs12979860 genotypes in patients with different treatment schedules are also displayed.
OR, Odds ratio; CI, confidence interval.

Results

Genotypes of the rs12979860 were unequivocally assigned in all the cases, except in one of the individuals with persistent infection, who was eliminated from the analysis (CHC genotypes n = 283), and they were in Hardy-Weinberg equilibrium in the NIS control group (CC: 44.7%, CT: 42.1%, and TT: 13.2%; C 0.66 and T 0.34). Demographic data, viral genotype and viral load, route of infection, fibrosis stage, and biochemical features of our CHC cohort are displayed in Table 1. With regard to the viral genotypes, 74.2% of the CHC patients were infected with viral genotype 1 (G1), 23.3% were infected with non-1 viral genotype (non-G1) (4.2% with genotype 2, 15.2% with genotype 3, and 3.9% with genotype 4), and the rest (2.5%) had co-infections with different HCV genotypes. When patients were stratified according to their rs12979860 genotypes (CC versus CT+TT), the CC genotype was overrepresented among non-G1 (66.7%) on comparing with both G1-infected patients (39.1%, P = 8.5 x 10-5, OR = 0.32, 95%CI = 0.17-0.60) and NIS (44.7%, P = 0.001, OR = 0.40, 95%CI = 0.22-0.72), whereas frequency of the CC genotype among G1-infected patients was similar to that of the NIS group (P = 0.18). Moreover, we found higher median levels of alanine aminotransferase (106.0 IU/L versus 85.5 IU/L, P = 0.006) and lower median levels of gamma-glutamyltransferase (35.5 IU/L versus 41.0 IU/L, P = 0.002) in patients CC when compared with patients CT+TT. No statistical significant differences between individuals CC and CT+TT were observed in any other cases (Table 1).

Results obtained regarding the effect of the rs12979860 variations in the spontaneous HCV clearance in our study are displayed in Table 2. The CC genotype was associated with the spontaneous resolution of infection; 72.5% of those individuals who cleared the virus had the CC genotype versus 44.7% of the NIS group (P = 2.2 x 10-5, OR = 0.31, 95%CI = 0.17- 0.56) and 45.6% of the CHC group (P = 6.2 x 10-5, OR = 0.32, 95%CI = 0.17-0.59), whereas individuals with persistent infection had a frequency of this genotype similar to that of the NIS group (CHC versus NIS, P = 0.82). Next, we tested whether the effect of this polymorphism was the same in both sexes, because this factor had been the most consistently associated with natural elimination of the virus. The rs12979860 CC genotype was associated with spontaneous clearance in both men and women. Regarding viral clearance after treatment, data of response were available in 219 patients; those 65 subjects without data of response were excluded from this part of the study. Viral clearance after treatment was associated with the IL28B locus, because frequency of rs12979860CC among patients with SR (n = 113) was 60.2% versus 32.1% found in patients with NSR (n = 106) (P = 3.1 x 10-5, OR = 0.31, 95%CI = 0.17-0.56). We found an association of this polymorphism with SR in the monotherapy as well as in the combined therapy groups. In the monotherapy group, frequency of CC patients with SR was 35 of 58 (60.3%) versus 20 of 54 (37.0%) among patients with NSR (P = 0.01, OR = 0.39, 95%CI = 0.17-0.89), and in the combined therapy group, frequency of CC patients with SR was 33 of 55 (60.0%) versus 14 of 52 (26.9%) among patients with NSR (P = 5.6 x 10-4, OR = 0.25, 95%CI = 0.10-0.60) (Table 3).Therefore, according to our data, distribution of rs12979860 genotypes relating to the response was the same in both treatment schedules, and consequently, we combined both therapy groups for analysis. Finally, when patients were stratified by their viral genotypes, the rate of SR in CC patients infected by non-G1 was 87.2% (34/39) and 84.2% in CT+TT patients infected by non-G1 (16/19, P = 0.76); whereas in patients CC infected with G1 was 53.9% (34/63) and in patients CT+TT infected with G1 was 29.6% (29/98, P = 1.98 x 10-3, OR = 0.36, 95%CI = 0.18-0.73).

Discussion

In this study, we found a preference of the HCV genotypes to infect individuals with a determinate rs12979860 genotype and association of the IL28B locus with spontaneous viral clearance as well as with the response to treatment in the Spanish population. Very recently, three genome-wide association studies have reported an association between the IL28B locus and the response to IFN-a and RBV therapy in HCV-infected patients.[4-6] In our study, the rs12979860CC genotype was overrepresented in SR patients. The association was detected in both patients treated with only IFN-a and patients treated with the combined therapy IFN-a and RBV. The group of patients bearing the genotype associated with a better response had lower pretreatment median levels of gamma glutamyltransferase, which is the aminotransferase more consistently associated with the SR, with OR comparable to viral genotype.[9-11] Levels of alanine aminotransferase were higher in our group of CC patients with CHC; although this aminotransferase has not been clearly associated with SR, some authors described association of higher levels in the baseline with SR in patients infected with non-G1.[12] Except for frequency of the viral genotypes, we did not find differences between both rs12979860 genotype groups and the rest of the factors analyzed previously described as related to SR. All three previous studies support a robust association of the IL28B locus with the response to the antiviral therapy across different population groups, including only viral genotype 1-infected patients. This is the most common viral genotype in developed countries and the poorest responder to therapy (40%-50% of responder versus 75% of patients infected with others genotypes). The current study included 23.3% of non-G1-infected patients, and, surprisingly, determinate HCV genotypes had preference by individuals with a particular rs12979860 genotype because the frequency of subjects bearing CC was overrepresented among non-G1-infected patients (66.7%). Although these results need confirmation in other cohorts, taking into account frequency of rs12979860 CC genotype in our noninfected population (44.7%), we could speculate with a possible positive selection of individuals rs12979860 CC by the non-G1 virus or, conversely, a negative selection of these subjects by the G1 (39.1%). In this sense, both the highest rs12979860 C allelic frequency and the greatest rate of infection by non-G1 viral HCV genotypes have been described in Asian populations, whereas the lowest frequency of C allele and the highest rates of G1 infection have been described in African populations.[4][13] Some studies support the idea that elements of both innate and adaptive immune response could be under selective pressure in viral infections, and this fact could determine the final picture found in observational studies.[14-16] There exists no systematic explanation for the viral genotype-specific differences found in response to treatment; therefore, if non-G1 viral genotypes had a preference to infect patients with a determinate IL28B genotype, influence currently attributed to the virus could be caused, at least partially, by the host genetic background. Although the individuals included in some combinations of viral and host genotypes did not permit statistical analysis, our results suggest an influence of both host and virus factors in the SR. In this sense, the highest rate of SR was found in CC patients infected by non-G1 (87.2%) and the lowest among individuals CT+TT infected with G1 (29.6%). The influence of the host genotype could be stronger among individuals infected by G1 (rate of response of CC 53.9% versus 29.6% in CT+TT) than among those infected by non-G1 (rate of response of CC 87.2% versus 84.2% in CT+TT).

Further studies are needed to clarify the weight of these factors in the response. Another question is whether this gene is involved in natural viral clearance. During the preparation of this manuscript, a paper describing an association of this SNP with natural viral clearance in six different cohorts of individuals with different ethnic origins was published.[7] This study reported association of this polymorphism with natural viral clearance among American individuals with both European and African ancestry. The current study shows a similar association between rs12979860 and natural viral clearance, because frequency of the CC genotype was overrepresented in individuals with spontaneous viral clearance. Therefore, our results support the same conclusion as the previous study in a Spanish cohort. This association seems to be independent of sex, which is a factor consistently associated with natural clearance.

In conclusion, we have found different rates of viral genotype infection depending on IL28B variant as well as an association of this locus with natural and treatment-mediated response.

Patients and Methods

A total cohort consisting of 731 Spanish individuals were included in this study. They were selected by using surnames and by having grandparents born in Spain. This cohort included 284 subjects with persistent infection, 69 individuals who naturally cleared the virus, and 378 noninfected subjects. The persistent infection group included 166 males and 118 females suffering from biopsy-proven chronic hepatitis C (CHC) with compensated liver disease followed in the outpatient clinic of the Hospital Universitario Virgen del Rocio and Hospital Universitario de Valme (Sevilla, Spain) from 2001 to 2004. All CHC patients were hepatitis B surface antigen and human immune deficiency virus negative, anti-HCV positive, and HCV RNA positive in serum. Anti-HCV, HbsAg, and human immune deficiency virus were determined by commercially available methods (HCV 3.0 test, ORTHO, and Enzygnost hepatitis B surface antigen 5.0 and anti-human immune deficiency virus-1/2 plus; DADE, Behring, respectively). Percutaneous liver biopsies were performed under ultrasonographic control. A portion of the biopsy specimen was used for the histology diagnosis. Disease staging was defined according to Scheuer,[8] with ranking from F0 (absence of fibrosis) to F4 (cirrhosis stage). Patients were stratified into two groups: F0-F2, absence of fibrosis to moderate fibrosis; and group F3-F4, with advanced fibrosis-cirrhosis. Data of response to treatment (51.4% received IFN-a, and 48.6% IFN-a plus RVB) were available in 219 patients; 113 of them had a sustained response (SR), HCV RNA levels remained undetectable during 6 months after therapy discontinuation) and 106 had a nonsustained response (NSR), including nonresponder patients (HCV RNA levels detectable during the completed period of the treatment) and relapsed responder patients (undetectable HCV RNA during the therapy but detectable after discontinuation).

The group with spontaneous viral clearance comprised 29 men and 40 women who were anti-HCV positive and HCV-RNA negative. Most of these subjects were blood donors with anti-HCV positive in the routine screening of viral antibodies; these subjects are referred to the hepatology unit and, according to the established protocol, HCV-RNA detection is performed. Lastly, a group of 223 male and 155 female blood and bone marrow donors (noninfected subjects [NIS]) were considered as representative of the normal frequencies of the SNP studied in the Spanish population. Patients and controls agreed to a blood examination according to the guidelines of the Hospital Bioethic Committee.

Genotyping.

DNA from patients and controls was extracted from peripheral blood using standard methods. Genotyping of the rs12979860 was performed using a TaqMan 5 allelic discrimination assay (Applied Biosystems, Foster City, CA). The primers used were 5 GCCTGTCGTGTACTGAACCA 3 (forward) and 5 GCGCGGAGTGCAATTCAAC 3 (reverse), and the TaqMan MGB probe sequences were 5 TGGTTCGCGCCTTC 3 and 5 CTGGTTCACGCCTTC 3. The probes were labeled with the fluorescent dyes VIC and FAM, respectively. Polymerase chain reaction reactions were carried out in a total volume of 8 uL with the following amplification protocol: denaturation at 95¡C for 10 minutes, followed by 40 cycles of denaturation at 92¡C for 15 seconds, and finished with annealing and extension at 60¡C for 1 minute. Genotyping of each sample was automatically attributed by the SDS 1.3 software for allelic discrimination.

Statistical Analysis.

Genotypic frequencies were obtained by direct counting, and statistical analysis was performed by the chi-squared test calculated on 2 x 2 contingency tables assuming a recessive model (CC versus CT+TT) using the Statcalc program (Epi Info version 6.0; Centers for Disease Control and Prevention, Atlanta, GA). Odds ratio (OR) with 95% confidence intervals (95% CI) was calculated using the same program. Median values of quantitative variables were compared using a nonparametric test (Mann-Whitney two-tailed test). P-values less than 0.05 were considered statistically significant.

References

1 Thomas DL, Seeff LB. Natural history of hepatitis C. Clin Liver Dis 2005; 9: 383-398.

2 Kenny-Walsh E. Clinical outcomes after hepatitis C infection from contaminated anti-D immunoglobulin: Irish Hepatology Research Group. N Engl J Med 1999; 340: 1228-1233.

3 Kau A, Vermehren J, Sarrazin C. Treatment predictors of a sustained virologic response in hepatitis B and C. J Hepatol 2008; 49: 634-651.

4 Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, et al. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 2009; 46: 399-401.

5 Suppiah V, Moldovan M, Ahlenstiel G, Berg T, Weltman M, Abate ML, et al. IL28B is associated with response to chronic hepatitis C interferon- and ribavirin therapy. Nat Genet 2009; 41: 1100-1104

6 Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, et al. Genome-wide association of IL28B with response to pegylated interferon- and ribavirin therapy for chronic hepatitis C. Nat Genet 2009; 41: 1105-1109.

7 Thomas DL, Thio CL, Martin MP, Qi Y, Ge D, O'Huigin C, et al. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature 2009; 461: 798-801.

8 Scheuer PJ. Classification of chronic viral hepatitis: a need for reassessment. J Hepatol 1991; 13: 372-373.

9 Berg T, von Wagner M, Nasser S, Sarrazin C, Heintges T, Gerlach T, et al. Extended treatment duration for hepatitis C virus type 1: comparing 48 versus 72 weeks of peginterferon-alfa-2a plus ribavirin. Gastroenterology 2006; 130: 1086-1097.

10 Berg T, Sarrazin C, Herrmann E, Hinrichsen H, Gerlach T, Zachoval R, el al. Prediction of treatment outcome in patients with chronic hepatitis C: significance of baseline parameters and viral dynamics during therapy. HEPATOLOGY 2003; 37: 600-609.

11 von Wagner M, Huber M, Berg T, Hinrichsen H, Rasenack J, Heintges T, et al. Peginterferon-alpha-2a (40KD) and ribavirin for 16 or 24 weeks in patients with genotype 2 or 3 chronic hepatitis C. Gastroenterology 2005; 129: 522-527.

12 Shiffman ML, Suter F, Bacon BR, Nelson D, Harley H, Sol‡ R, et al. Peginterferon alfa-2a and ribavirin for 16 or 24 weeks in HCV genotype 2 or 3. N Engl J Med 2007; 357: 124-134.

13 Yu ML, Chuang WL. Treatment of chronic hepatitis C in Asia: when East meets West. J Gastroenterol Hepatol 2009; 24: 336-345.

14 Pang PS, Planet PJ, Glenn JS. The evolution of the major hepatitis C genotypes correlates with clinical response to interferon therapy. PLoS One 2009; 11: e6579.

15 Telenti A. Adaptation, co-evolution, and human susceptibility to HIV-1 infection. Infect Genet Evol 2005; 5: 327-334. Links

16 Kawashima Y, Pfafferott K, Frater J, Matthews P, Payne R, Addo M, et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature 2009; 458: 641-645.
 
http://www.natap.org/2010/HCV/062910_01.htm

Tips to Protect Yourself From Hospital Negligence

Wednesday, June 30, 2010
By Dr. Manny Alvarez

There have been a number of published reports this year about staff several VA hospitals using unsterilized equipment and exposing their patients to infectious diseases.

The most recent occurred at the John Cochran VA Medical Center in St. Louis. Tuesday, the hospital sent out letters to 1,800 veterans who had been treated recently for dental work, and said that the patients may have come in contact with HIV or hepatitis B and C because of instruments that were not cleaned properly.

Congressman Russ Carnahan is launching a federal investigation into this matter. In the meantime the hospital has set up clinics and education centers to help patients who could have potentially been infected.

To hear of such negligent acts coming from a VA hospital is totally unconscionable and should never be tolerated. In the past couple of years, we have heard about malicious health care personnel who ― for some reason or another ― have purposely infected patients or administered medication inappropriately, but a case where a health care facility and/or health care personnel fails to have good infection control, the potential to harm hundreds of innocent victims is overwhelming.

If nothing else, what medical history has taught us, is that hospitals infections are on the rise. For the last five years, massive education coming from federal health agencies have mandated that doctors, nurses, and technical personnel that work in a hospital understand and follow good infection control policies so that patients will not be exposed to dangerous diseases.

Many hospitals are doing a good job, but clearly, from what we can learn of these recent reports – a lot of work needs to be done.

It is particularly upsetting to me because VA hospitals should represent the best health care available – especially because their purpose is to provide services to our men and women in uniform who have sacrificed so much.

So let us hope that this is a wake-up call to the Obama administration to beef up the quality and the prestige of our federally-funded health services.

Now, let me give you some tips on how you can protect yourself from becoming a victim of poor infection control in the hospital:

Demand that all health care personnel wash their hands in front of you before they render any physical service;

Demand that all health care personnel wear NEW gloves before drawing any blood;

Make sure your health care provider opens new needles from new packaging in your presence;

If any injectable medication is to be administered, it must come from a new bottle;

If you do not feel comfortable in your current setting, ask to speak to the infection control officer at your health facility. It is your right.

Like I always say: It’s my hope that some day all health care facilities will provide the best care available, but it seems that in the meantime, we all need to be on the alert.

http://www.foxnews.com/story/0,2933,595643,00.html

VA hospital may have infected 1,800 veterans with HIV

By the CNN Wire Staff

(CNN) -- A Missouri VA hospital is under fire because it may have exposed more than 1,800 veterans to life-threatening diseases such as hepatitis and HIV.

John Cochran VA Medical Center in St. Louis has recently mailed letters to 1,812 veterans telling them they could contract hepatitis B, hepatitis C and human immunodeficiency virus (HIV) after visiting the medical center for dental work, said Rep. Russ Carnahan.

Carnahan said Tuesday he is calling for a investigation into the issue and has sent a letter to President Obama about it.

"This is absolutely unacceptable," said Carnahan, a Democrat from Missouri. "No veteran who has served and risked their life for this great nation should have to worry about their personal safety when receiving much needed healthcare services from a Veterans Administration hospital."

The issue stems from a failure to clean dental instruments properly, the hospital told CNN affiliate KSDK.

KSDK: VA dental patients at risk of infection

Dr. Gina Michael, the association chief of staff at the hospital, told the affiliate that some dental technicians broke protocol by handwashing tools before putting them in cleaning machines.

The instruments were supposed to only be put in the cleaning machines, Michael said.

The handwashing started in February 2009 and went on until March of this year, the hospital told KSDK.

The hospital has set up a special clinic and education centers to help patients who may have been infected. However, Carnahan said he feels more should be done and those responsible should be disciplined.

"I can only imagine the horror and anger our veterans must be feeling after receiving this letter," Carnahan said. "They have every right to be angry. So am I."

This is not the first time this year a hospital has been in hot water for not following proper procedures.

In June, Palomar Hospital in San Diego, California, has sent certified letters to 3,400 patients who underwent colonoscopy and other similar procedures, informing the patients that there may be a potential of infection from items used and reused in the procedures.

http://www.cnn.com/2010/US/06/30/va.hospital.hiv/